The human skeletal alpha-actin promoter is regulated by thyroid hormone: identification of a thyroid hormone response element.

Collie E.S. and Muscat G.E. (1992) The human skeletal alpha-actin promoter is regulated by thyroid hormone: identification of a thyroid hormone response element.. Cell growth & differentiation : the molecular biology journal of the American Association for Cancer Research, 3 1: 31-42.

Author Collie E.S.
Muscat G.E.
Title The human skeletal alpha-actin promoter is regulated by thyroid hormone: identification of a thyroid hormone response element.
Journal name Cell growth & differentiation : the molecular biology journal of the American Association for Cancer Research   Check publisher's open access policy
ISSN 1044-9523
Publication date 1992-01-01
Year available 1992
Sub-type Article (original research)
Volume 3
Issue 1
Start page 31
End page 42
Total pages 12
Place of publication PHILADELPHIA
Language eng
Subject 1307 Cell Biology
1312 Molecular Biology
Abstract Skeletal alpha-actin mRNA increases in the adult heart during cardiac hypertrophy after the imposition of hemodynamic overload/aortic restriction. 3,3',5-Triiodo-L-thyronine (T3) elicits a cardiac response similar to the effect of prolonged exercise and was recently shown to cause a rapid increase in the amount of skeletal alpha-actin mRNA in hearts from normal and hypophysectomized animals. We used transient transfection analysis to show that T3 induces the expression of the native skeletal alpha-actin promoter between nucleotide positions -2000 and +239 linked to the chloramphenicol acetyltransferase reporter gene in COS-1 fibroblasts and myogenic C2C12 cells. This T3 (10-100 nm)-induced transcriptional activation is dependent on the expression of the thyroid hormone receptors from transfected alpha-1 and beta-1 c-erbA complementary DNA expression vectors. Electrophoretic mobility shift assays were used to identify a thyroid hormone response element (TRE) in the human skeletal alpha-actin gene. This TRE is located between nucleotide positions -173 and -149 with respect to the start of transcription at +1 (5' TGGTCAACGCAGGGGACCCGGGCGG 3'). Electrophoretic mobility shift assay experiments showed that the putative skeletal alpha-actin TRE and defined rodent growth hormone TREs (that bind thyroid hormone receptors in vitro and in vivo) interacted with an identical nuclear factor in vitro in muscle cells that was developmentally regulated during myogenesis. Transient transfection analysis utilizing 5' unidirectional deletions of the skeletal alpha-actin promoter indicated that cis-acting sequences between, nucleotide positions -432 and -153, which encompassed the TRE, were required for T3/thyroid hormone receptor-dependent trans-activation in vivo. Furthermore, we demonstrated that the skeletal alpha-actin TRE is juxtaposed next to SRF and SpI binding sites, at its 5' and 3' flanks, respectively. It is also surrounded by sequences densely populated by other SpI, SRF, and CTF binding sites. In conclusion, these results indicate that T3-induced increases in alpha-actin mRNA in animals are mediated by a direct transcriptional mechanism that may involve interactions with ubiquitous proteins.
Keyword Rat Growth-Hormone
Chain Fusion Gene
Rna Polymerase-Ii
Cardiac Actin
Glucocorticoid Receptor
Transcription Factor
Q-Index Code C1
Institutional Status Unknown

Document type: Journal Article
Sub-type: Article (original research)
Collection: Scopus Import
Version Filter Type
Citation counts: TR Web of Science Citation Count  Cited 21 times in Thomson Reuters Web of Science Article | Citations
Scopus Citation Count Cited 17 times in Scopus Article | Citations
Google Scholar Search Google Scholar
Created: Tue, 13 Sep 2016, 10:40:27 EST by System User