Identification of a thyroid hormone response element in the mouse myogenin gene: Characterization of the thyroid hormone and retinoid X receptor heterodimeric binding site

Downes M., Griggs R., Atkins A., Olson E.N. and Muscat G.E.O. (1993) Identification of a thyroid hormone response element in the mouse myogenin gene: Characterization of the thyroid hormone and retinoid X receptor heterodimeric binding site. Cell Growth and Differentiation, 4 11: 901-910.

Author Downes M.
Griggs R.
Atkins A.
Olson E.N.
Muscat G.E.O.
Title Identification of a thyroid hormone response element in the mouse myogenin gene: Characterization of the thyroid hormone and retinoid X receptor heterodimeric binding site
Journal name Cell Growth and Differentiation   Check publisher's open access policy
ISSN 1044-9523
Publication date 1993-01-01
Year available 1993
Sub-type Article (original research)
Open Access Status Not yet assessed
Volume 4
Issue 11
Start page 901
End page 910
Total pages 10
Place of publication PHILADELPHIA
Publisher AMER ASSOC CANCER RESEARCH
Language eng
Subject 1307 Cell Biology
1312 Molecular Biology
Abstract Thyroid hormones are positive regulators of muscle development in vivo. Triiodo-L-thyronine (T-3) treatment of myogenic cell lines results in the precocious expression of myogenin, a muscle specific, helix-loop-helix factor that can trans-activate muscle specific gene expression (G. Carnac et al., Mol. Endocrinol., 6: 1185-1194, 1992). We have identified a T-3 response element (TRE) in the mouse myogenin (MM) promoter between nucleotide positions -526 and -494 (5' GTGGTAGGTCTTTAGGGGTCTCATGGACTGACA 3'). This sequence conferred appropriate hormonal regulation to an enhancerless SV40 promoter. Electrophoretic mobility shift analysis experiments showed that thyroid hormone receptor alpha (TR alpha) and retinoid X receptor alpha (RXR alpha) formed a heterodimeric complex on the MM TRE that was specifically competed by classical TREs and not by other response elements. Analyses of this heterodimer with a battery of steroid hormone response elements indicated that the complex was efficiently competed by a direct repeat of the AGGTCA motif separated by 4 nucleotides, as predicted by the 3-4-5 rule. Electrophoretic mobility shift analysis experiments showed that the myogenin, growth hormone, and myosin heavy chain TREs interacted with an identical nuclear factor(s) in muscle cells that was constitutively expressed during myogenesis. Mutagenesis of the MM TRE indicated that the sequence of the direct repeats (AGGTCA) and the 4-nucleotide gap were necessary for efficient binding to the TR alpha/RXR alpha heterodimeric complex. In conclusion, our data suggest that the MM TRE is a target for direct cross-talk between two different hormonal signals (T-3 and 9-cis-retinoic acid) at the receptor level. To our knowledge, this is the first identification and characterization of a hormonal response element in the muscle specific helix-loop-helix family that directly interacts with TR alpha and RXR alpha. These results indicate that the thyroid hormones, which are positive regulators of myogenic terminal differentiation, directly target the hierarchical regulators of myogenesis.
Keyword Cell Biology
Cell Biology
Q-Index Code C1
Q-Index Status Provisional Code
Institutional Status Unknown

Document type: Journal Article
Sub-type: Article (original research)
Collection: Scopus Import - Archived
 
Versions
Version Filter Type
Citation counts: TR Web of Science Citation Count  Cited 55 times in Thomson Reuters Web of Science Article | Citations
Scopus Citation Count Cited 51 times in Scopus Article | Citations
Google Scholar Search Google Scholar
Created: Tue, 14 Jun 2016, 15:31:59 EST by System User